{"title":"Adam Rutherford","description":"\u003cp\u003eExplore the captivating works of Adam Rutherford, blending science, history, and culture. Uncover the hidden stories within genetics and human evolution, perfect for curious minds seeking knowledge and insight.\u003c\/p\u003e","products":[{"product_id":"rutherford-and-frys-complete-guide-to-absolutely-everything-abridged-book-adam-rutherford-9780552176712","title":"Rutherford and Frys Complete Guide to Absolutely Everything (Abridged)","description":"THE SUNDAY TIMES BESTSELLER  'Explores just about every area of life' DAILY MAIL  'If only Adam Rutherford and Hannah Fry were on tap to all of us, all the time . . . The pair have such a gift for making life, numbers and the forces at work in the universe all the richer, stranger, funnier and more marvellous.' Stephen Fry  In Rutherford and Fry's comprehensive guidebook, they tell the complete story of the universe and absolutely everything in it - skipping over some of the boring parts.  This is a celebration of the weirdness of the cosmos, the strangeness of humans and the fact that amid all the mess, we can somehow make sense of life.  Our brains have evolved to tell us all sorts of things that feel intuitively right but just aren't true: the world looks flat, the stars seem fixed in the heavenly firmament, a day is 24 hours... This book is crammed full of tales of how stuff really works. With the power of science, Rutherford and Fry show us how to bypass our monkey-brains, taking us on a journey from the origin of time and space, via planets, galaxies, evolution, the dinosaurs, all the way into our minds, and wrestling with some truly head-scratching questions that only science can answer:  What is time, and where does it come from? Why are animals the size and shape they are? How horoscopes work (Spoiler: they don't, but you think they do) Does my dog love me? Why nothing is truly round? Do you need your eyes to see?  'A wonderfully engaging blend of wit, enthusiasm, clarity and knowledge.' Bill Bryson  'Like the universe itself, this book is multi-faceted, surprising and full of wonders. It's also funny, wise and exceedingly brainy. You really owe it to yourself to read it.' Tim Harford, author of How To Make The World Add Up","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49504443498769,"sku":"GOR012622968","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":49605482053905,"sku":"GOR012846098","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49740901581073,"sku":"NGR9780552176712","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":49894871564561,"sku":"GOR013809228","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50484908720401,"sku":"CIN0552176710G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":50525318938897,"sku":"GOR012725296","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52432720429329,"sku":"NLS9780552176712","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0552176710.jpg?v=1750741378"},{"product_id":"book-of-humans-book-adam-rutherford-9780297609407","title":"The Book of Humans","description":"'Charming, compelling and packed with information. I learned more about biology from this short book than I did from years of science lessons. A weird and wonderful read' PETER FRANKOPAN      We like to think of ourselves as exceptional beings, but is there really anything special about us that sets us apart from other animals? Humans are the slightest of twigs on a single family tree that encompasses four billion years, a lot of twists and turns, and a billion species. All of those organisms are rooted in a single origin, with a common code that underwrites our existence. This paradox - that our biology is indistinct from all life, yet we consider ourselves to be special - lies at the heart of who we are.  In this original and entertaining tour of life on Earth, Adam Rutherford explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves. Evolution has, however, allowed us to develop our culture to a level of complexity that outstrips any other observed in nature.  THE BOOK OF HUMANS tells the story of how we became the creatures we are today, bestowed with the unique ability to investigate what makes us who we are. Illuminated by the latest scientific discoveries, it is a thrilling compendium of what unequivocally fixes us as animals, and reveals how we are extraordinary among them.  With illustrations by Alice Roberts","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49504856310033,"sku":"GOR009350136","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49638800883985,"sku":"GOR009415277","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":49645464486161,"sku":"GOR010766443","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":51412703346961,"sku":"GOR009304157","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0297609408.jpg?v=1750781197"},{"product_id":"book-of-humans-book-adam-rutherford-9781780229089","title":"The Book of Humans","description":"A thrilling new examination of what sets us apart in the animal kingdom by the popular science broadcaster and author of A BRIEF HISTORY OF EVERYONE WHO EVER LIVED","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49510230163729,"sku":"GOR009806932","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49560023990545,"sku":"GOR010214187","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49735420576017,"sku":"NGR9781780229089","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50291420922129,"sku":"GOR010116601","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50400889209105,"sku":"CIN1780229089G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":51356682486033,"sku":"GOR010637511","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1780229089.jpg?v=1751059584"},{"product_id":"rutherford-and-frys-complete-guide-to-absolutely-everything-abridged-book-adam-rutherford-9781787632639","title":"Rutherford and Frys Complete Guide to Absolutely Everything (Abridged)","description":"THE SUNDAY TIMES BESTSELLER 'Explores just about every area of life' DAILY MAIL 'If only Adam Rutherford and Hannah Fry were on tap to all of us, all the time . . . The pair have such a gift for making life, numbers and the forces at work in the universe all the richer, stranger, funnier and more marvellous.'  Stephen Fry  In Rutherford and Fry's comprehensive guidebook, they tell the complete story of the universe and absolutely everything in it - skipping over some of the boring parts. This is a celebration of the weirdness of the cosmos, the strangeness of humans and the fact that amid all the mess, we can somehow make sense of life.   Our brains have evolved to tell us all sorts of things that feel intuitively right but just aren't true: the world looks flat, the stars seem fixed in the heavenly firmament, a day is 24 hours... This book is crammed full of tales of how stuff really works. With the power of science, Rutherford and Fry show us how to bypass our monkey-brains, taking us on a journey from the origin of time and space, via planets, galaxies, evolution, the dinosaurs, all the way into our minds, and wrestling with some truly head-scratching questions that only science can answer:   What is time, and where does it come from?  Why are animals the size and shape they are?  How horoscopes work (Spoiler: they don't, but you think they do)  Does my dog love me?  Why nothing is truly round?  Do you need your eyes to see?  'A wonderfully engaging blend of wit, enthusiasm, clarity and knowledge.' Bill Bryson 'Like the universe itself, this book is multi-faceted, surprising and full of wonders. It's also funny, wise and exceedingly brainy. You really owe it to yourself to read it.' Tim Harford, author of How To Make The World Add Up","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49510776832273,"sku":"GOR011826550","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49665627390225,"sku":"GOR012252429","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50127805350161,"sku":"CIN1787632636VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50128766632209,"sku":"CIN1787632636G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50679106666769,"sku":"GOR011730713","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":50870048063761,"sku":"GOR011955693","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1787632636.jpg?v=1751422829"},{"product_id":"where-are-you-really-from-book-adam-rutherford-9781526364241","title":"Where Are You Really From?","description":"*Winner of The Week Junior's Children's Book of the Year: STEM 2024!*  'Laugh out loud funny - and you'll learn lots too!' - Adam Kay, author of Kay's Anatomy and Kay's Incredible Inventions.  'If I had had such a book when I was 10 or 11, I might well have set my sights on becoming a geneticist or some kind of biologist...' - Stephen Fry   Go on an extraordinary adventure through millions of years of human history and learn the story of our species from evolution to dinosaurs to YOU!   Along the way, you will meet kings and queens, Pharaohs and Vikings, and see just how far and wide humans have migrated around the world. You'll discover why we're related to a super cheesy man and that no matter what skin colour you have, language you speak or place you are from - we all share the same small pool of ancestors.  Mind-boggling, entertaining and illuminating, this is the epic story of you and everyone who has ever lived!   'A BRILLIANT book about biology and belonging. Packed to its covers with fascinating facts, science and joy; I have a ten year old son who will LOVE this book.' - Dr Alice Roberts, author of Wolf Road and The Incredible Human Journey  'Funny, silly and utterly rigorous - a book that will inspire awe and wonder in all that read it. It stands a better chance of making the world a better place than any book I've read recently.' - Dr Chris van Tulleken, author of Ultra Processed People","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49511244464401,"sku":"GOR013254546","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49740455805201,"sku":"NGR9781526364241","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49980013642001,"sku":"GOR013827900","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":51111344079121,"sku":"GOR013358966","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ INGRAM","offer_id":52453834588433,"sku":"NLS9781526364241","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1526364247.jpg?v=1751431402"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9781780229072","title":"A Brief History of Everyone Who Ever Lived","description":"A dazzling tour of the latest genetic discoveries which are blurring the boundaries between science and history - 'Brilliant, authoritative, surprising, captivating' BRIAN COX","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49514752770321,"sku":"GOR008729298","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49530836746513,"sku":"GOR008805730","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49735841579281,"sku":"NGR9781780229072","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ GOOD \/ SBYB","offer_id":49762165457169,"sku":"CIN1780229070G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":49779292733713,"sku":"GOR009097980","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50228297564433,"sku":"GOR009017412","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50299603812625,"sku":"CIN1780229070VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":50390159851793,"sku":"CIN1780229070A","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ INGRAM","offer_id":52139090215185,"sku":"NLS9781780229072","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1780229070.jpg?v=1770374875"},{"product_id":"out-of-nothing-book-adam-rutherford-9781910620281","title":"Out of Nothing","description":"Spanning millennia, Daniel Locke's ambitious graphic novel explores humanity's inherent 'dreaming mind and its impact on our world. Surreal sequences take us from Gutenberg's printing press to Tim Berners-Lee's World Wide Web via Picasso, Einstein, Grandmaster Flash and more. Locke shows hour our basic instinct to observe, record and connect has formed the basis for all human invention and progress.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49516784156945,"sku":"GOR009661494","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":49527831920913,"sku":"GOR010686665","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50055845445905,"sku":"CIN1910620289G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":50700436930833,"sku":"GOR014039578","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50960144892177,"sku":"CIN1910620289VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":53183548129553,"sku":"GOR011036282","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1910620289.jpg?v=1751124091"},{"product_id":"book-of-humans-book-adam-rutherford-9780297609414","title":"The Book of Humans","description":"We like to think of ourselves as exceptional beings, but is there really anything special about us that sets us apart from other animals? Humans are the slightest of twigs on a single family tree that encompasses four billion years, a lot of twists and turns, and a billion species. All of those organisms are rooted in a single origin, with a common code that underwrites our existence. This paradox - that our biology is indistinct from all life, yet we consider ourselves to be special - lies at the heart of who we are.  In this original and entertaining tour of life on Earth, Adam Rutherford explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves. Evolution has, however, allowed us to develop our culture to a level of complexity that outstrips any other observed in nature.  THE BOOK OF HUMANS tells the story of how we became the creatures we are today, bestowed with the unique ability to investigate what makes us who we are. Illuminated by the latest scientific discoveries, it is a thrilling compendium of what unequivocally fixes us as animals, and reveals how we are extraordinary among them.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49520312975633,"sku":"GOR009993829","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ GOOD \/ SBYB","offer_id":50262463840529,"sku":"CIN0297609416G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":50346584899857,"sku":"CIN0297609416A","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0297609416.jpg?v=1750781197"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9780297609377","title":"A Brief History of Everyone Who Ever Lived","description":"This is a story about you.  It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex.    Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species.   In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49534367826193,"sku":"GOR007689616","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ WELL_READ \/ SBYB","offer_id":50346574807313,"sku":"CIN0297609378A","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50347846041873,"sku":"CIN0297609378G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50774625222929,"sku":"GOR008389935","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":50913715552529,"sku":"GOR008516833","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":51681525891345,"sku":"GOR010039144","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0297609378.jpg?v=1751424594"},{"product_id":"creation-book-adam-rutherford-9780670920440","title":"Creation","description":"Creation by Adam Rutherford uses the very latest science to provide the most up-to-date and comprehensive account yet of the story of life -- where it came from and where it is going.  'A superbly written explanation of how the origin of life on Earth became a question for science, and what the answer might be'  Brian Cox  'One of the most eloquent and genuinely thoughtful books on science over the past decade ... You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology ... Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Nick Lane, Observer  'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller. Fascinating'  Mail on Sunday  'This is a quite delightful two books in one. It is becoming increasingly clear that the 21st is the century of biology. This book is the perfect \"story so far\"'  Jim Al-Khalili  'An engaging account of both the mystery of life's origin and its impending resolution, as well as a fascinating glimpse of the impending birth of a new, synthetic biology'   Matt Ridley  Recent breakthroughs in the science of life are solving the great mystery of its origin while giving us the power to design its future. Presented here back-to-back, these two gripping narratives reveal the full story of creation.  The Origin of Life takes the reader on a gripping, four-billion-year journey of discovery to explain what life is, where it came from and in what form it first appeared. From interplanetary collisions to the inner-workings of cells and genes, it offers answers to the very grandest of questions before arriving at a thrilling solution to the greatest detective story of them all.  The Future of Life introduces a new chapter in human history: living technology. Our mastery of genetics now allows us to create entirely new life-forms within the laboratory - goats that produce spider silk in their milk, bacteria that excrete diesel, cells that identify and destroy tumours - but this revolutionary technology is fraught with controversy, not least the fear of bioterrorism. While introducing us to these remarkable innovations and explaining how they work, Adam Rutherford presents a powerful argument for their benefit to humankind.  'The perfect primer on the past and future of DNA ... Rutherford tells his stories with great brio and a disarming line in personal commentary'  Guardian  'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English'  Financial Times  'Fascinating ... The extraordinary science and his argument are worth every reader's scrutiny'  Sunday Telegraph  'Suspenseful, erudite and thrilling'  Prospect  'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know'  Dara O Briain  'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers'  Alice Roberts  'A fascinating glimpse into our past and future ... [Rutherford] argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve'  Sunday Times  Dr Adam Rutherford is a geneticist, writer and broadcaster, whose work includes the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous programmes for BBC Radio 4. He is an editor at the science journal Nature, writes for the Guardian and has given numerous prestigious lectures, as well as appearing in the 'Uncaged Monkeys' tour.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49545543516433,"sku":"GOR005426427","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":49566218780945,"sku":"GOR010734074","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49663634112785,"sku":"GOR006046046","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0670920444.jpg?v=1751168274"},{"product_id":"creation-book-adam-rutherford-9780241954690","title":"Creation","description":"Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives.  'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller'  Mail on Sunday  The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, offering answers to the very grandest of questions before arriving at a thrilling solution.  'A superbly written explanation'  Brian Cox  This same science has led to a technological revolution: the ability to create entirely new life forms within the lab, known as synthetic biology. The Future of Life introduces these remarkable innovations, explains how they work, and presents a powerful argument for their benefit to humankind.  'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating.'  Sunday Telegraph  'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet'  Observer  'The perfect primer on the past and future of DNA'  Guardian  'Susenseful, erudite and thrilling'  Prospect  'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know'  Dara O Briain  'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology'  Jim Al Khalili  'A fascinating glimpse into our past and future. Rutherford argues persuasively against those who seek to hold back scientific progress. His illuminating book is full of optimism about what we might be able to achieve'  Sunday Times  'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating'  PopularScience.co.uk  'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers'  Alice Roberts  'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology''  Matt Ridley, author of Genome  'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English'  Financial Times  Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book.  TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49550006321425,"sku":"GOR005657825","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49732528800017,"sku":"NGR9780241954690","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ GOOD \/ SBYB","offer_id":50346250109201,"sku":"CIN024195469XG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":52109236896017,"sku":"GOR006577698","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/024195469X.jpg?v=1750876912"},{"product_id":"control-book-adam-rutherford-9781474622387","title":"Control","description":"* FROM THE SUNDAY TIMES BESTSELLING AUTHOR OF HOW TO ARGUE WITH A RACIST *  Throughout history, people have sought to improve society by reducing suffering, eliminating disease or enhancing desirable qualities in their children. But this wish goes hand in hand with the desire to impose control over who can marry, who can procreate and who is permitted to live. In the Victorian era, in the shadow of Darwin's ideas about evolution, a new full-blooded attempt to impose control over our unruly biology began to grow in the clubs, salons and offices of the powerful. It was enshrined in a political movement that bastardised science, and for sixty years enjoyed bipartisan and huge popular support.   Eugenics was vigorously embraced in dozens of countries. It was also a cornerstone of Nazi ideology, and forged a path that led directly to the gates of Auschwitz. But the underlying ideas are not merely historical. The legacy of eugenics persists in our language and literature, from the words 'moron' and 'imbecile' to the themes of some of our greatest works of culture. Today, with new gene editing techniques, very real conversations are happening - including in the heart of British government - about tinkering with the DNA of our unborn children, to make them smarter, fitter, stronger.   CONTROL tells the story of attempts by the powerful throughout history to dictate reproduction and regulate the interface of breeding and society. It is an urgently needed examination that unpicks one of the defining and most destructive ideas of the twentieth century. To know this history is to inoculate ourselves against its being repeated.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49616329015569,"sku":"GOR012173060","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":49806737801489,"sku":"GOR012263595","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":50150790856977,"sku":"GOR012763615","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ GARDNERS","offer_id":50697999024401,"sku":"NGR9781474622387","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":50913730396433,"sku":"GOR014119624","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1474622380.jpg?v=1751422860"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9780297609384","title":"A Brief History of Everyone Who Ever Lived","description":"This is a story about you.  It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex.    Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species.   In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.","brand":"WoB","offers":[{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":49655864852753,"sku":"GOR009470652","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50347797840145,"sku":"CIN0297609386G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":51421103259921,"sku":"GOR014268394","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":51701243379985,"sku":"GOR008079842","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":53617695490321,"sku":"GOR012548497","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0297609386.jpg?v=1750738160"},{"product_id":"control-book-adam-rutherford-9781474622394","title":"Control","description":"How did an obscure academic idea pave the way to the Holocaust within just fifty years? Why does eugenics still loom large in the 21st century, despite its genocidal past? Did eugenics work? Could it work? Or was it always a pseudoscientific fantasy?      Throughout history, people have sought to reduce suffering, eliminate disease and enhance desirable qualities in their children. In the Victorian era eugenics, a full-blooded attempt to impose control over unruly biology, began to grow among the powerful and quickly spread to dozens of countries around the world. But these ideas are not merely historical: today, with new gene editing techniques, conversations are happening about tinkering with the DNA of our unborn children to make them smarter, fitter, stronger. Deeply steeped in contemporary genetics, CONTROL offers a vital account of one of the defining - and most destructive - ideas of the twentieth century.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49667394863377,"sku":"GOR013071460","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ GARDNERS","offer_id":49743570534673,"sku":"NGR9781474622394","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50207968723217,"sku":"GOR013178041","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ WELL_READ \/ INTERNAL","offer_id":50519141384465,"sku":"GOR013983026","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":50633270526225,"sku":"GOR013161589","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ INGRAM","offer_id":52139882643729,"sku":"NLS9781474622394","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1474622399.jpg?v=1766659019"},{"product_id":"genetics-book-adam-rutherford-9780718188276","title":"Genetics","description":"Part of the ALL-NEW LADYBIRD EXPERT SERIES. ____________  Who discovered genetics?  How does gene inheritance work?  Is DNA common to all living things?   We inherit CODES from our parents. And these codes are written in the molecule DNA. This DNA means that we RESEMBLE each other, namely our families.  This raises so many questions such as how does DNA influence evolution? How was it discovered? And what does it mean for the future of the human race?  Discover the answers and more inside Adam Rutherford's Ladybird Expert - Genetics, the thrilling and accessible account that explains race and genetics, whether it is our DNA or the environment that influences us most, what are our chances of being related to royalty, genetic engineering and much more . . .","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49675418075409,"sku":"GOR009245770","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ GOOD \/ INTERNAL","offer_id":49897890349329,"sku":"GOR011436169","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":50712967676177,"sku":"GOR009905453","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0718188276.jpg?v=1750944695"},{"product_id":"how-to-argue-with-a-racist-book-adam-rutherford-9781615198306","title":"How to Argue With a Racist","description":"Race is not a biological reality.  Racism thrives on our not knowing this.    In fact, racist pseudoscience has become so commonplace that it can be hard to spot. But its toxic effects on society are plain to see: rising nationalism, simmering hatred, lost lives, and divisive discourse. Since cutting-edge genetics are difficult to grasp—and all too easy to distort—even well-intentioned people repeat stereotypes based on “science.” But the real science tells a different story: The more researchers learn about who we are and where we come from, the clearer it becomes that our racial divides have nothing to do with observable genetic differences. The bestselling author of A Brief History of Everyone Who Ever Lived explains in this explosive, essential guide to the DNA we all share.","brand":"WoB","offers":[{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":49709467042065,"sku":"CIN161519830XVG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":49950041997585,"sku":"CIN161519830XG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51870997217553,"sku":"NIN9781615198306","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/161519830X.jpg?v=1751057066"},{"product_id":"how-to-argue-with-a-racist-book-adam-rutherford-9781474611251","title":"How to Argue With a Racist","description":"THE SUNDAY TIMES BESTSELLER AS HEARD ON BBC RADIO 4 BOOK OF THE WEEK  'The ultimate anti-racism guide' Caroline Criado Perez 'Seriously important' Bill Bryson 'A fascinating debunking of racial pseudoscience' Guardian  Racist pseudoscience may be on the rise, but science is no ally to racists. Instead science and history can be powerful allies against bigotry, granting us the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST dismantles outdated notions of race by illuminating what modern genetics can and can't tell us about human difference. It is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify racism.  Updated edition includes a new Preface from the author","brand":"WoB","offers":[{"title":"GB \/ NEW \/ GARDNERS","offer_id":49739181654289,"sku":"NGR9781474611251","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ GOOD \/ SBYB","offer_id":50333341679889,"sku":"CIN1474611257G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":50378020618513,"sku":"CIN1474611257A","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ INGRAM","offer_id":52120954405137,"sku":"NLS9781474611251","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":53366077587729,"sku":"CIN1474611257VG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1474611257.jpg?v=1765448513"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9781615194940","title":"A Brief History of Everyone Who Ever Lived","description":"In our unique genomes, every one of us carries the story of our species--births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away--until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story--from 100,000 years ago to the present.","brand":"WoB","offers":[{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":49745029366033,"sku":"CIN1615194940VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":50320468345105,"sku":"GOR011857233","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ LIKE_NEW \/ SBYB","offer_id":50386179195153,"sku":"CIN1615194940LN","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51039964102929,"sku":"NIN9781615194940","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":52106997825809,"sku":"CIN1615194940G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":52153491751185,"sku":"CIN1615194940A","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1615194940.jpg?v=1750895860"},{"product_id":"complete-guide-to-absolutely-everything-abridged-book-adam-rutherford-9780393881578","title":"The Complete Guide to Absolutely Everything (Abridged)","description":"The complete story of the universe and absolutely everything in it (minus the boring parts).","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":49775341601041,"sku":"CIN0393881571G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":49940898087185,"sku":"CIN0393881571VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":53058680488209,"sku":"CIN0393881571A","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0393881571.jpg?v=1751292972"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9781615194049","title":"A Brief History of Everyone Who Ever Lived","description":"\u003cb\u003eNational Book Critics Circle Award--2017 Nonfiction Finalist\u003c\/b\u003e\u003cbr\u003e\u003cbr\u003e \u003cb\u003eNothing less than a tour de force--a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.--\u003ci\u003eThe New York Times Book Review, \u003c\/i\u003eEditor's Choice\u003c\/b\u003e\u003cbr\u003e\u003cbr\u003e\u003cb\u003e\u003ci\u003eA National Geographic\u003c\/i\u003e Best Book of 2017\u003c\/b\u003e\u003cbr\u003e\u003cbr\u003e In our unique genomes, every one of us carries the story of our species--births, deaths, disease, war, famine, migration, and \u003ci\u003ea lot\u003c\/i\u003e of sex.\u003cbr\u003e\u003cbr\u003e But those stories have always been locked away--until now.\u003cbr\u003e\u003cbr\u003e Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story--from 100,000 years ago to the present.\u003cbr\u003e\u003cbr\u003e\u003ci\u003eA Brief History of Everyone Who Ever Lived\u003c\/i\u003e will upend your thinking on Neanderthals, evolution, royalty, race, and even redheads. (For example, we now know that at least four human species once roamed the earth.) Plus, here is the remarkable, controversial story of how our genes made their way to the Americas--one that's still being written, as ever more of us have our DNA sequenced.\u003cbr\u003e\u003cbr\u003e Rutherford closes with A Short Introduction to the Future of Humankind, filled with provocative questions that we're on the cusp of answering: Are we still in the grasp of natural selection? Are we evolving for better or worse? And . . . where do we go from here?","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":49787916648721,"sku":"CIN1615194045G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":49930244292881,"sku":"CIN1615194045VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":51409255956753,"sku":"GOR009024286","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ WELL_READ \/ SBYB","offer_id":53266542330129,"sku":"CIN1615194045A","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1615194045.jpg?v=1751455259"},{"product_id":"humanimal-book-adam-rutherford-9781615195312","title":"Humanimal","description":"Publisher’s note: Humanimal was published in the UK under the title The Book of Humans.    Evolutionary theory has long established that humans are animals: Modern Homo sapiens are primates who share an ancestor with monkeys and other great apes. Our genome is 98 percent identical to a chimpanzee’s. And yet we think of ourselves as exceptional. Are we?    In this original and entertaining tour of life on Earth, Adam Rutherford explores the profound paradox of the “human animal.” Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: In Australia, raptors have been observed starting fires to scatter prey; in Zambia, a chimp named Julie even started a “fashion” of wearing grass in one ear. We aren’t the only species that communicates, makes tools, or has sex for reasons other than procreation. But we have developed a culture far more complex than any other we’ve observed. Why has that happened, and what does it say about us?    Humanimal is a new evolutionary history—a synthesis of the latest research on genetics, sex, migration, and much more. It reveals what unequivocally makes us animals—and also why we are truly extraordinary.","brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":49869317177617,"sku":"GOR013803052","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50312714649873,"sku":"CIN1615195319VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":50395278016785,"sku":"CIN1615195319G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":52817171972369,"sku":"CIN1615195319A","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ LIKE_NEW \/ INTERNAL","offer_id":53333174157585,"sku":"GOR014852947","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1615195319.jpg?v=1751088683"},{"product_id":"how-to-argue-with-a-racist-book-adam-rutherford-9781615196715","title":"How to Argue With a Racist","description":"Racist pseudoscience has become so commonplace that it can be hard to spot. But its toxic effects on society are plain to see—feeding nationalism, fueling hatred, endangering lives, and corroding our discourse on everything from sports to intelligence. Even well-intentioned people repeat stereotypes based on “science,” because cutting-edge genetics are hard to grasp—and all too easy to distort. Paradoxically, these misconceptions are multiplying even as scientists make unprecedented discoveries in human genetics—findings that, when accurately understood, are powerful evidence against racism. We’ve never had clearer answers about who we are and where we come from, but this knowledge is sorely needed in our casual conversations about race.    How to Argue With a Racist emphatically dismantles outdated notions of race by illuminating what modern genetics actually can and can’t tell us about human difference. We now know that the racial categories still dividing us do not align with observable genetic differences. In fact, our differences are so minute that, most of all, they serve as evidence of our shared humanity.","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":50013592682769,"sku":"CIN1615196714G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50155697504529,"sku":"CIN1615196714VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51231669190929,"sku":"NIN9781615196715","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1615196714.jpg?v=1751342830"},{"product_id":"a-brief-history-of-everyone-who-ever-lived-the-stories-in-our-genes-rare-book-adam-rutherford-1717077132dpb","title":"A Brief History of Everyone Who Ever Lived: The Stories in Our Genes","description":"2016. First Edition. 419 pages. No dust jacket. Signed by the author. Paper covered boards. Flatsigned by the author to half title page. Pages are bright and clear with no visible markings. Binding th","brand":"WoB","offers":[{"title":"GB \/ GOOD \/ INTERNAL","offer_id":50088824570129,"sku":"1717077132DPB","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1717077132DPB_1.jpg?v=1722934964"},{"product_id":"control-book-adam-rutherford-9781324066132","title":"Control","description":"Control is a book about eugenics, what geneticist Adam Rutherford calls “a defining idea of the twentieth century.” Inspired by Darwin’s ideas about evolution, eugenics arose in Victorian England as a theory for improving the British population, and quickly spread to America, where it was embraced by presidents, funded by Gilded Age monopolists, and enshrined into racist American laws that became the ideological cornerstone of the Third Reich. Despite this horrific legacy, eugenics looms large today as the advances in genetics in the last thirty years—from the sequencing of the human genome to modern gene editing techniques—have brought the idea of population purification back into the mainstream.   Eugenics has “a short history, but a long past,” Rutherford writes. The first half of Control is the history of an idea, from its roots in key philosophical texts of the classical world all the way into their genocidal enactment in the twentieth century. The second part of the book explores how eugenics operates today, as part of our language and culture, as part of current political and racial discussions, and as an eternal temptation to powerful people who wish to improve society through reproductive control.   With disarming wit and scientific precision, Rutherford explains why eugenics still figures prominently in the twenty-first century, despite its genocidal past. And he confronts insidious recurring questions—did eugenics work in Nazi Germany? And could it work today?—revealing the intellectual bankruptcy of the idea, and the scientific impossibility of its realization.","brand":"WoB","offers":[{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50092262686993,"sku":"CIN132406613XVG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51022999847185,"sku":"NIN9781324066132","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":51499044602129,"sku":"CIN132406613XG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/132406613X.jpg?v=1750793017"},{"product_id":"iceland-s-great-inheritance-book-adam-rutherford-9780934666411","title":"Iceland's Great Inheritance","description":null,"brand":"WoB","offers":[{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":50315295392017,"sku":"GOR013923183","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0934666415.jpg?v=1751171632"},{"product_id":"book-of-humans-book-adam-rutherford-9781615195909","title":"The Book of Humans","description":"Publisher’s Note: The Book of Humans was previously published in hardcover as Humanimal.    In this new evolutionary history, geneticist Adam Rutherford explores the profound paradox of the human animal. Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: We aren’t the only species that “speaks,” makes tools, or has sex outside of procreation. Seeing as our genome is 98 percent identical to a chimpanzee’s, our DNA doesn’t set us far apart, either. How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.","brand":"WoB","offers":[{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":50386201182481,"sku":"CIN1615195904VG","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ GOOD \/ SBYB","offer_id":53547546509585,"sku":"CIN1615195904G","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1615195904.jpg?v=1750830589"},{"product_id":"creation-book-adam-rutherford-9781617230110","title":"Creation","description":"Today's scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge \"synthetic biology\" may lead to solutions to some of the world's most pressing crises and pave the way for inventions once relegated to science fiction. \u003cp\u003e\u003cbr\u003e Meanwhile, these advances are shedding new light on the biggest mystery of all--how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.\u003c\/p\u003e","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":50395689255185,"sku":"CIN1617230111G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51293995368721,"sku":"NIN9781617230110","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":53561669157137,"sku":"CIN1617230111VG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1617230111.jpg?v=1751246943"},{"product_id":"jake-s-secret-book-teddy-slater-marilee-harrald-p-9780439897082","title":"Jake's Secret","description":"Perfect for young children, read and share stories about Jesus and those that he told. From the popular 99 Stories from the Bible, each lively narrative is simply told across a double page spread with bold, engaging illustrations that bring the story to life. Join Jesus changing water into wine at the wedding party, choosing his disciples, healing, feeding a hungry crowd and walking on the lake. Enjoy retelling Jesus' stories about the lost son, the missing sheep and the kind stranger.","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":50466514206993,"sku":"CIN0439897084G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":51719265321233,"sku":"CIN0439897084VG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/0439897084.jpg?v=1751071551"},{"product_id":"creation-book-adam-rutherford-9781617230059","title":"Creation","description":"Today's scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge synthetic biology may lead to solutions to some of the world's most pressing crises and pave the way for inventions once relegated to science fiction.\u003cp\u003e\u003cbr\u003eMeanwhile, these advances are shedding new light on the biggest mystery of all--how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.\u003c\/p\u003e","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":50469888524561,"sku":"CIN1617230057G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ WELL_READ \/ SBYB","offer_id":51325793239313,"sku":"CIN1617230057A","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":52811307548945,"sku":"GOR007944896","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":53240738087185,"sku":"CIN1617230057VG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1617230057.jpg?v=1751408073"},{"product_id":"control-book-adam-rutherford-9781324035602","title":"Control","description":"Control is a book about eugenics, what geneticist Adam Rutherford calls “a defining idea of the twentieth century.” Inspired by Darwin’s ideas about evolution, eugenics arose in Victorian England as a theory for improving the British population, and quickly spread to America, where it was embraced by presidents, funded by Gilded Age monopolists, and enshrined into racist American laws that became the ideological cornerstone of the Third Reich. Despite this horrific legacy, eugenics looms large today as the advances in genetics in the last thirty years—from the sequencing of the human genome to modern gene editing techniques—have brought the idea of population purification back into the mainstream.   Eugenics has “a short history, but a long past,” Rutherford writes. The first half of Control is the history of an idea, from its roots in key philosophical texts of the classical world all the way into their genocidal enactment in the twentieth century. The second part of the book explores how eugenics operates today, as part of our language and culture, as part of current political and racial discussions, and as an eternal temptation to powerful people who wish to improve society through reproductive control.   With disarming wit and scientific precision, Rutherford explains why eugenics still figures prominently in the twenty-first century, despite its genocidal past. And he confronts insidious recurring questions—did eugenics work in Nazi Germany? And could it work today?—revealing the intellectual bankruptcy of the idea, and the scientific impossibility of its realization.","brand":"WoB","offers":[{"title":"US \/ GOOD \/ SBYB","offer_id":50763812143377,"sku":"CIN1324035609G","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ NEW \/ INGRAM","offer_id":51023211397393,"sku":"NIN9781324035602","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"GB \/ NEW \/ GARDNERS","offer_id":51201565491473,"sku":"NGR9781324035602","price":0.0,"currency_code":"GBP","in_stock":false},{"title":"US \/ VERY_GOOD \/ SBYB","offer_id":51423696716049,"sku":"CIN1324035609VG","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1324035609.jpg?v=1751402705"},{"product_id":"control-book-adam-rutherford-9786067225341","title":"Control","description":null,"brand":"WoB","offers":[{"title":"- \/ - \/ -","offer_id":51465540534545,"sku":"","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":51465540600081,"sku":"GOR014290679","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/6067225344.jpg?v=1751253586"},{"product_id":"new-revelation-in-the-great-pyramid-book-adam-rutherford-9781258995614","title":"New Revelation in the Great Pyramid","description":null,"brand":"WoB","offers":[{"title":"- \/ - \/ -","offer_id":51644651766033,"sku":"","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ NEW \/ INGRAM","offer_id":51644651995409,"sku":"NIN9781258995614","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/1258995611.jpg?v=1751336016"},{"product_id":"cum-sa-combati-un-rasist-book-adam-rutherford-9786067224443","title":"Cum Sa Combati Un Rasist","description":null,"brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52389227495697,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ VERY_GOOD \/ INTERNAL","offer_id":52389227823377,"sku":"GOR014512584","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9786067224443.jpg?v=1758450309"},{"product_id":"wie-man-mit-rassisten-diskutiert-book-adam-rutherford-9783662633496","title":"Wie man mit Rassisten diskutiert","description":"Dieses Buch ist ein wichtiges Manifest für das Verständnis der menschlichen Evolution und Variation im 21. Jahrhundert. Es leistet einen bedeutenden Beitrag zur aktuellen Diskussion über die Rasse. Klischees und Mythen über Rassen werden nicht nur von offenkundigen Rassisten zum Ausdruck gebracht. Auch gut meinende Menschen vertreten durch ihren kulturellen Erfahrungshorizont Ansichten, die nicht durch die moderne Humangenetik gestützt werden. Sogar der wissenschaftliche Rassismus greift zunehmend um sich und beeinflusst den öffentlichen Diskurs über Politik, Migration, Bildung, Sport und Intelligenz. Der Leser bekommt Argumente an die Hand, um dem entgegen zu treten. Adam Rutherford zeigt, dass die moderne Humangenetik ein mächtiger Verbündeter gegen Rassismus sein kann. Sie zeigt, wie Menschen tatsächlich sind, und nicht, wie sie von der Gesellschaft gesehen werden.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52485748261137,"sku":"NLS9783662633496","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ NEW \/ INGRAM","offer_id":53548607471889,"sku":"NIN9783662633496","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783662633496.jpg?v=1759858148"},{"product_id":"bin-ich-etwas-besonderes-book-adam-rutherford-9783662615652","title":"Bin ich etwas Besonderes?","description":"Vor etwa 45.000 Jahren haben wir Menschen uns mit der Schaffung von Kultur, Werkzeugen, Symbolik und Kunst von unseren Vorfahren und Ursprungen entfernt. Alle Arten sind einzigartig, aber sind wir einzigartiger als andere Tiere?    Diese Frage geht an die Wurzel dessen, was wir sind.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52688828662033,"sku":"NLS9783662615652","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ NEW \/ INGRAM","offer_id":52761909068049,"sku":"NIN9783662615652","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783662615652.jpg?v=1762333915"},{"product_id":"brief-history-of-everyone-who-ever-lived-book-adam-rutherford-9781399638982","title":"A Brief History of Everyone Who Ever Lived","description":"This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex.    In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ GARDNERS","offer_id":52957981999377,"sku":"NGR9781399638982","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":53582449475857,"sku":"NLS9781399638982","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9781399638982.jpg?v=1779961713"},{"product_id":"new-revelation-in-the-great-pyramid-1948-book-adam-rutherford-9780766133846","title":"New Revelation in the Great Pyramid (1948)","description":"This scarce antiquarian book is a facsimile reprint of the original. Due to its age, it may contain imperfections such as marks, notations, marginalia and flawed pages. Because we believe this work is culturally important, we have made it available as part of our commitment for protecting, preserving, and promoting the world's literature in affordable, high quality, modern editions that are true to the original work.","brand":"WoB","offers":[{"title":"US \/ NEW \/ INGRAM","offer_id":53380895277329,"sku":"NIN9780766133846","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9780766133846.jpg?v=1775510782"}],"url":"https:\/\/www.worldofbooks.com\/en-au\/collections\/author-books-by-adam-rutherford.oembed?page=3","provider":"World of Books ","version":"1.0","type":"link"}