{"title":"Nato Asi Subseries H","description":null,"products":[{"product_id":"photosensitisation-book-giuliana-moreno-9783642731532","title":"Photosensitisation","description":"Radiation induces a variety of chemical processes in biological tissues. This volume is a synthesis of up-to-the-minute reviews on such photochemical and photobiological sensitized reactions with particular relevance to photomedicine. The first part gives a description of experimental techniques for the study of the primary processes after radiation absorption by biological systems. It is followed by chapters on singlet oxygen and photomedicine, considering both phototherapy and photochemotherapy. These sections also discuss the next generation of potential photosensitizing drugs.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089206898961,"sku":"NLS9783642731532","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642731532.jpg?v=1756906238"},{"product_id":"intracellular-regulation-of-ion-channels-book-martin-morad-9783642846304","title":"Intracellular Regulation of Ion Channels","description":"Proceedings of the NATO Advanced Research Workshop on Intracellular Modulation of Cardiac and Neuronal Ion Channels at Il Ciocco, Lucca (Italy) from April 26-30, 1991","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089218367761,"sku":"NLS9783642846304","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846304.jpg?v=1756906294"},{"product_id":"mechanism-of-fertilization-plants-to-humans-book-brian-dale-9783642839672","title":"Mechanism of Fertilization: Plants to Humans","description":"The majority of scientists interested in fertilization and early developmental processes will undoubtably have encountered the works of Alberto Monroy at some time in their careers. Alberto's contribution to this field spans oogenesis to embryogenesis, where he used physiological, biochemical and morphological tools to answer a number of basic problems in cell biology. This multi-disciplinary approach, together with his remarkable intellectual flexibility and humour has had an enormous impact on this field and all those fortunate enough to have worked with him. The chapters in this book have been divided into four sections. The initial presentations revolve around late events of gameteogenesis, that lead to a physiologically mature gamete. Probably the most exciting area for research at the moment is the identification of the cytoplasmic mechanisms responsible for the meiotic arrest of oocytes and the factors responsible for initiating their maturation (Chapters 3 and 4). Less is known about the physiological changes in the male gamete in preparation for fertilization and this may be identified as a major area for future research. Although comparable data for the plant kingdom is presently restricted to studies on marine algae, new techniques for isolating angiosperm gametes (Chapters 1 and 17) promise rapid advances in this field. The second section looks at the events and molecules involved in gamete recognition, binding and fusion. One of the most controversial topics is when does sperm-egg fusion actually occur (Chapter 14).","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089383387409,"sku":"NLS9783642839672","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839672.jpg?v=1756906980"},{"product_id":"cell-to-cell-signals-in-plants-and-animals-book-volker-neuhoff-9783642764721","title":"Cell to Cell Signals in Plants and Animals","description":"Summarizing research progress achieved in 32 areas of cell biology covered in this series, this volume places special emphasis on the following topics: recognition in parasitic and symbiotic systems - the molecular biology and genetics of susceptibility and resistance of plants and animals to pathogens, parasites and symbionts - the cell to cell recognition and differentiation - the most challenging problems in developmental biology of plants and animals - the plasticity in cell to cell communication which plays a major role in cell differentiation and function.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089383715089,"sku":"NLS9783642764721","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642764721.jpg?v=1756906981"},{"product_id":"effects-of-mineral-dusts-on-cells-book-brooke-t-mossman-9783642742057","title":"Effects of Mineral Dusts on Cells","description":"The Fourth International Workshop on In Vitro Effects of Mineral Dusts on Cells was held on September 20 - 23, 1988 in Auberge Estrimont, Orford, Quebec, Canada. The emphasis of the N. A. T. O. Advanced Research Workshop was the use of cell and organ culture and lavage cell populations obtained from man and laboratory animals to elucidate cellular and molecular events occur- ring after their interaction with fibrous and nonfibrous particulates, including metal compounds. In seven sessions, an international representation of scientists from 17 countries (Austria, Belgium, Canada, France, Federal Republic of Germany, India, Japan, Netherlands, Norway, Poland, Portugal, Union of South Africa, Sweden, Switzerland, United Kingdom, United States of America, and Yugoslavia) presented recent research findings in the following areas: Epithelial cell injury and proliferation by minerals. Physico-chemical properties of minerals in relation to their biologic effects. Mechanisms of dust-induced pneumoconioses. Clinical and experimental studies. Mechanisms of cytotoxicity, mutagenicity and carcinogenicity. Oxidants, cytotoxicity and disease. Mechanisms of mineral-induced inflammation. Mechanisms of carcinogenesis. A session on Questions, risk and public policy provided a lively discussion on the relevance of in vitro experiments to carcinogenicity studies in man and their implications in the formation of regulatory policies. VI The organizing committee for this workshop was: Co-Chairs: B. T. Mossman (USA) and R. Begin (Canada) E. G. Beck (FRG) A. Lange (Poland) A. Brody (USA) P. Nettesheim (USA) R. C. Brown (UK) Q. Rahman (India) J. Bignon (France) K. Robock (FRG) Fisher G.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089383878929,"sku":"NLS9783642742057","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642742057.jpg?v=1756906982"},{"product_id":"biomarkers-book-david-b-peakall-9783642846335","title":"Biomarkers","description":"Biological markers used to assess the effects of environmental pollution have attracted considerable attention from regulatory agencies and are currently under evaluation at a number of research facilities throughout the world. However promising a biomarker-based biomonitoring approach may be, the development of this concept is complicated by a range of technical issues. This book provides a conceptional framework for research and application of biomarkers. International experts on biomonitoring have formulated a unified strategy for the development and validation of biomarkers in assessing environmental health as well as appropriate protocols for their implementation and interpretation in a biological monitoring program.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089384534289,"sku":"NLS9783642846335","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846335.jpg?v=1756906985"},{"product_id":"prader-willi-syndrome-book-suzanne-b-cassidy-9783642842856","title":"Prader-Willi Syndrome","description":"Although Prader-Willi syndrome was first described 35 years ago, it was following detection of an interstitial chromosome 15q deletion in some affected patients ten years ago that it became a major focus of multidisciplinary scientific interest. This interest was compounded by the later determination that some patients with a clinically distinct disorder, Angelman syndrome, apparently also had the same chromosome 15q deletion. Subsequently, molecular genetic studies showed that some cytogenetically normal patients with both disorders have uniparental disomy, maternal in Prader-Willi syndrome and paternal in Angelman syndrome. Genetic imprinting has been implicated in this unusual phenomenon. This Workshop was conceived to bring together clinical and basic scientists from around the world whose research was focused on unraveling this unique genetic situation and further delineating these two fascinating disorders. As this volume demonstrates, it was successful in reaching this goal. Laboratory and clinical scientists from 15 countries in four continents participated, and even more countries were represented among the professional and parent observers of its proceedings. Many participants had previously known each other in print only. As a consequence of the Workshop, conclusions could be drawn on several issues. International collaborative research efforts were established. And acquaintances were developed between people who investigate the genetics of these disorders from differing perspectives, resulting in enrichment of approach to answering the complex questions posed by these fascinating conditions. Plans were initiated for another such scientific workshop a few years hence. This volume includes papers presented from the platform.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089387254033,"sku":"NLS9783642842856","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642842856.jpg?v=1756906996"},{"product_id":"cell-separation-in-plants-book-daphne-j-osborne-9783642741630","title":"Cell Separation in Plants","description":"This NATO Advanced Research Workshop held 25-30 September, 1988 at the Villa Gualino, Turin, Italy, was the first international meeting of its kind to be devoted solely to cell separation in plants. The partial or complete dissociation of one cell from another is an integral process of differentiation. Partial cell separations are basic physiological components of the overall programme of plant development. Complete cell separations are major events in the ripening of fruits, and the shedding of plant parts. Unscheduled cell separations commonly occur when tissues are subjected to pathogenic invasion. Environmental stresses too, evoke their own separation responses. Over the past five years much new knowledge has been acquired on the regulation of gene expression in specific stages of cell differentiation. Specific molecular markers have been identified that designate the competence of cells for achieving separation. Certain of the chemical signals (hormones, elicitors) that must be emitted or perceived by cells to initiate and sustain separation, are now known to us, and the resulting cell wall changes have come under close chemical scrutiny. The Turin meeting was a focus for those currently involved in such investigations. It assessed factors controlling cell separation in a wide spectrum of different cell types under a variety of conditions.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52089393578257,"sku":"NLS9783642741630","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741630.jpg?v=1756907021"},{"product_id":"plant-molecular-biology-book-gloria-coruzzi-9783642788543","title":"Plant Molecular Biology","description":"Presented here is an analysis of plant development and plant metabolism using the tools of genetics and molecular biology, such as mutant analysis, mutation tagging, mapping using polymorphic characters and basic molecular biology techniques. Studies with a range of model genetic organisms, most notably maize and Arabidopsis, are included. The reader gains a comprehensive view of the subject which is more and more of both scientific and industrial interest. The value of basic research in plants is highlighted and examples where basic studies have led to applications in agricultural biotechnology are given.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52126373675281,"sku":"NLS9783642788543","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642788543.jpg?v=1757475838"},{"product_id":"biomechanics-of-active-movement-and-division-of-cells-book-nuri-akkas-9783642789779","title":"Biomechanics of Active Movement and Division of Cells","description":"The NATO Advanced Study Institute on Biomechanics of Active Movement and Division of Cells was held September 19-29, 1993 in Istanbul and the Proceedings are presented in this volume. Sixty-eight scientists from sixteen countries attended. Prof. J. Bereiter-Hahn of Goethe-Universitat, Frankfurt, Germany, Prof. A.K. Harris of the University of North Carolina, Chapel Hill, USA, Prof. R.M. Nerem of Georgia Institute of Technology, Atlanta, USA and Prof. R. Skalak of the University of California, San Diego, USA were the members of the International Organizing Committee. As the Scientific Director of the Institute, I wish to express my sincere appreciation for their assistance without which the Institute could not have taken place. This Institute is the third one of the meetings which are now called the NATO Istanbul Meetings on Cytomechanics. The first one was the NATO Advanced Research Workshop on Biomechanics of Cell Division which was held October 12-17, 1986 in Istanbul. The Proceedings were published as NATO ASI Series A Life Sciences Vol. 132 by Plenum Press in 1987. The second one was the NATO Advanced Study Institute on Biomechanics of Active Movement and Deformation of Cells which was held September 3-13, 1989 in Istanbul. The Proceedings were published as NATO ASI Series H: Cell Biology Vol. 42 by Springer-Verlag in 1990.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52126648729873,"sku":"NLS9783642789779","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642789779.jpg?v=1757477562"},{"product_id":"molecular-mechanisms-of-membrane-traffic-book-d-james-morre-9783662029305","title":"Molecular Mechanisms of Membrane Traffic","description":"The study of membrane traffic in reconstituted cell-free systems has generated an unprecedented amount of new information on the biochemistry, molecular biology and genetics of membrane-based molecular events that underly normal and abnormal cellular function. Many of the individual steps have now been isolated and dissected in simple systems that permit detailed molecular analyses of transport mechanisms and their regulation. Reconstituted events of intercompartment transport include inter-membrane recognition, and controlled membrane fusion-fission reactions. Among the many advances is the growi ng awareness of a remarkabl e evolutionary conservation of many of the components involved in the many steps of membrane traffic, this realization has accelerated greatly the pace of progress in the field. This book provides a collection of participant contributions from the 1992 Summer Research Conference, \"Mol ecul ar Mechani sms of Membrane Traffi c, \" jointly sponsored with NATO by the American Society of Cell Biology. The conference was held May 9-13, at the Airlie Conference Center in the Virginia countryside, near Warrenton. The conference was attended by 158 scientists. A unique feature was the high proportion of young scientists among the participants. Approximately 65% were students, postdoctoral fe 11 ows and young investigators. Each attendee contri buted to the conference with either a pl atform or poster presentation.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52140825346321,"sku":"NLS9783662029305","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783662029305.jpg?v=1757575779"},{"product_id":"biochemical-and-cellular-mechanisms-of-stress-tolerance-in-plants-book-joe-h-cherry-9783642791352","title":"Biochemical and Cellular Mechanisms of Stress Tolerance in Plants","description":"Environmental stresses, such as high and low temperature, salinity, and drought, represent limiting factors to agricultural productivity worldwide. Their impact is not only on crops that are presently being cultivated, but they are also significant barriers to the introduction of crop plants into noncultivated areas. The book describes the cellular, biochemical, and molecular mechanisms in plants that regulate tolerance to stresses. Also discussed are prospects of engineering stress-tolerant plants through the modification of germplasm.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52140847104273,"sku":"NLS9783642791352","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642791352.jpg?v=1757575879"},{"product_id":"glial-neuronal-communication-in-development-and-regeneration-book-hans-h-althaus-9783642713835","title":"Glial-Neuronal Communication in Development and Regeneration","description":"This comprehensive volume is a contribution to a new se ries initiated by the NATO Panel on Gell to Gell Signals in Plants and Animals. The book reflects the outcome of an NATO work- shop and bri ngs to mi nd two im portant questions: consideri ng the mass of relevant I iteratu reavai- able, is there any necessity for a new series of books - and considering the flood of compa- rable meetings - is there any point in workshops of this nature and their publication? In order to deal with such questions adequately, much more space would be needed than is available in a foreword. Thus, the answers must remain rather superficial and, of course, rather subjective. To simplify the issue, the question of publication can be narrowed down to two fac- tors - the financial risk, undertaken by the publisher, and the scientific risk, borne by the editor. If the book is good (with respect to lay-out and content) it will be a success - nothing will be lost- the people involved will enhance their reputation  We are left with the question of the usefulness of workshops. Without doubt, it is indeed a useful procedure for experts to come together, in an atmosphere of harmony, and freedom from external pressures and time limitations, to discuss a well-defined theme. Wether in agreement or disagreement, a fair and open forum can be expectet for a variety of contributions.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52143569666321,"sku":"NLS9783642713835","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642713835.jpg?v=1757585066"},{"product_id":"tin-based-antitumour-drugs-book-marcel-gielen-9783642741937","title":"Tin-Based Antitumour Drugs","description":"Whereas platinum compounds are already clinically used as anticancer agents, tin compounds exhibiting high enough antitumour activity have not yet been found to enter the clinical phase. This is paradoxical with the observation that 50% of the tested compounds showed some activity, which is an abnormally high percentage. This is probably due to the fact that research of this type with tin compounds started more recently than with platinum compounds and that almost exclusively known compounds coming from laboratories working in the field of organotin compounds have been blindly tested. Some research directed towards the development of organotin compounds with some biologically favourable properties, for instance derivatives with hydrophilic or lipophilic, or with increased bio-availability characteristics, has started only recently. We thought that was now the appropriate time to bring together experts from different disciplines (biochemists, pharmacologists, organotin chemists, oncologists, etc.) working in the field of tin-based antitumour drugs, to contribute to the critical assessment of existing knowledge in this new important topic, to identify the directions for future research and to promote close working relations between the different countries and professional experiences gathered in this workshop.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52143792521489,"sku":"NLS9783642741937","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741937.jpg?v=1757586010"},{"product_id":"plant-hormone-receptors-book-dieter-klmbt-9783642727818","title":"Plant Hormone Receptors","description":"The Nato Advanced Research Workshop on Plant Hormone Receptors was held at the Physik Zentrum in Bad Honnef near Bonn, August 18-22, 1986. This workshop was mainly supported by the Nato Scientific Affairs Division and additionally cosponsered by Hoechst AG, Frankfurt and BASF AG, Ludwigshafen. The workshop aimed at focusing research on plant hormone recep- tors. It should provide an opportunity to all who work in this field to report on their very recent data and to discuss their results with the most competent' colleagues. The total number of participants was limited to 30 to ensure personal contact and intensive discussions. Everyone had to either give a lecture or practical course. One half of the participants were invited, the other was selected by applications. Plant hormone receptors are assumed to exist but clear results are still rare. Nevertheless encouraging results have been published over the last years. Receptors for animal hormones and neuronal transmitters are well characterized, both structu- rally and functionally. Therefore scientists dealing with recep- tors for steroid hormones - Prof. E.E. Baulieu, Paris and Prof. J. R. Gustafsson, Huddinge - and for acetylcholine - Prof. A. Maelicke, Dortmund - were invited to participate in the workshop.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52143941320977,"sku":"NLS9783642727818","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642727818.jpg?v=1757586678"},{"product_id":"mechanics-of-swelling-book-theodoros-k-karalis-9783642846212","title":"Mechanics of Swelling","description":"Provided here is up-to-date and in-depth information on various swelling    phenomena occurring in living organisms and in the unanimated world. Thebook is arranged in six parts, which cover fundamentals, special topics,    analytical and experimental methods and applications relevant to swelling insoils, cells and tissues of plants and animals. Specifically, it            includes all aspects of osmotic phenomena leading to swelling in clays, cells, tissues, gels, blisters, colloidal systems, surfaces and membranes.  Forces between surfactant, lipid and protein membranes and in polymeric     systems are also considered.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52144113549585,"sku":"NLS9783642846212","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846212.jpg?v=1757587473"},{"product_id":"phytotoxins-and-plant-pathogenesis-book-antonio-graniti-9783642731808","title":"Phytotoxins and Plant Pathogenesis","description":"Proceedings of the NATO Advanced Research Workshop on Phytotoxins and Plant Pathogenesis held at Capri, Italy, May 30 - June 3, 1988","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52144231055633,"sku":"NLS9783642731808","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642731808.jpg?v=1757587960"},{"product_id":"dynamics-of-membrane-assembly-book-jos-af-op-den-kamp-9783662028629","title":"Dynamics of Membrane Assembly","description":"The meeting on Dynamics of Membrane Assembly., sponsored by NATO Scientific Affairs Division as an Advanced Study Institute and by FEBS as a Lecture Course was held in Cargese, France, in June 1991. The program included introductory lectures, specialized up-to-date contributions and poster sessions. Emphasis was laid on the new developments in the field of membrane biogenesis, in particular on the biosynthesis of phospholipids and the application of modern genetic techniques in these studies; on the membrane insertion and translocation of proteins; on intracellular protein and membrane traffic; and on the mutual interactions between the various events occurring during membrane biogenesis. Much progress in these research areas has been made in recent years and the ASI provided an excellent opportunity to illustrate this progress in comparison with previous meetings on a similar topic. Not only graduate students and postdocs took advantage from this program but also experienced scientists were given the opportunity to obtain a complete overview of recent progress and the remodelling of ideas and concepts.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52147119751441,"sku":"NLS9783662028629","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783662028629.jpg?v=1757599480"},{"product_id":"cellular-integration-of-signalling-pathways-in-plant-development-book-fiorella-lo-schiavo-9783642721199","title":"Cellular Integration of Signalling Pathways in Plant Development","description":"In the last few years there have been tremendous advances in the understanding of signals and signalling pathways that operate at the cellular level and lead to developmental processes. In 27 chapters, this volume investigates the cellular and molecular basis of plant development. It highlights the most recent progress on signals, machinery, and pathways in the plant cell. Emphasis is placed on integrating these studies with those on cell division, cell plate formation, and other aspects of plant development, in order to elucidate the intricate relationships between them.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52341180498193,"sku":"NLS9783642721199","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642721199.jpg?v=1758171433"},{"product_id":"neurocytochemical-methods-book-andre-calas-9783642843006","title":"Neurocytochemical Methods","description":"The great strides made in the field of morphological methods during the past decades have perhaps found their most spectacular expression in the functional exploration of the nervous system. In comparison with other tissues, nerve tissue displays three kinds of specificity : structural, because of the unique organization of the neuronal networks ; chemical as shown, for example, by the informative molecules exchanged between the nerve cells, and of course functional, thanks to the particular metabolic and electrophysiological characteristics of the neurons. Although for a long time the structural properties of the nervous system were generally considered to constitute the only field to which morphological techniques could be applied, we are to-day justified in believing that they can also explore the nerve tissue through its specific chemical and functional aspects, thanks to the development of immunocytochemistry and in situ hybridization, to the elaboration of the deoxyglucose method, to the use of voltage or ion sensitive dyes, and to the progress made in the application of in vivo techniques like PET. These methods have evolved so fast, the technical and fundamental problems they raise are so numerous and stimulating, and the importance of the complementary data they provide is so obvious, that we thought it was a good time to organize a new meeting between distinguished specialists in the neurocytochemical field.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52341280211217,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52341284110609,"sku":"NLS9783642843006","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642843006.jpg?v=1758171522"},{"product_id":"tumor-biology-book-asterios-s-tsiftsoglou-9783642647352","title":"Tumor Biology","description":"With the aim of providing an international forum for the communication of both the basic and clinical aspects of molecular and cellular biology of cancer, a NATO ASl was held in Porto Carras, Halkidiki, Greece, September 1-12, 1995. The principles as well as recent developments in tumor biology were discussed in depth, with emphasis on the regulation of the cell cycle, differentiation, programmed cell death (apoptosis) and genetics of cancer. This book constitutes the proceedings of that meeting. Specifically, the following areas were addressed: (a) enzymes and proteins (cyclins) that control the cell cycle, as well as the role of m as gene in meiosis and transformation; (b) the structural basis for specificity in protein-tyrosine kinase reactions; (c) the differentiation of normal as well as neoplastic cells with respect to molecular mechanism(s) by which chemical agents or growth factors trigger maturation; (d) phenotypic and genetic aspects of apoptosis; (e) the role of growth factors, like IGF-l, FGF, TN, IL-6, etc. , in cell cycle regulation, apoptosis (cell death) and senescence; (f) molecular mechanisms of transcriptional activation of globin genes and stability of mRNAs related to growth proteins and iron metabolism; (g) the cellular and molecular biology of bone marrow hemopoiesis; and (h) neurotrophic factors and the generation of cellular diversity in the central nervous system. It was obvious from the studies presented that neoplastic cell growth, differentiation and apoptosis in many cell types are regulated at several levels.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52341707178257,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52341710946577,"sku":"NLS9783642647352","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642647352.jpg?v=1758172028"},{"product_id":"flow-and-image-cytometry-book-alain-jaquemin-sablon-9783642647017","title":"Flow and Image Cytometry","description":"Image analysis and flow cytometry are complementary techniques which provide new insights into essential aspects of cell biology. This book presents an up-to-date overview of current ideas and methods in these domains. It consists of three parts. Part I, Membrane Dynamics and Function, deals with adhesion molecules, membrane pump dynamics, membrane fusion and endocytosis, membrane potential, T-cell homing and cytoskeleton, etc. The second part focuses on problems of cell proliferation, chromosome analysis and sorting, apoptosis, imaging cytometry of fixed and living cells, image analysis for gene mapping from flow-sorted chromosomes, chromatin organization, and liposome-mediated delivery of DNA binding drugs. The third part covers data management systems, cell sorting techniques and microscopy.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52341923840273,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52341927706897,"sku":"NLS9783642647017","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642647017.jpg?v=1758172232"},{"product_id":"biological-signal-transduction-book-elliott-m-ross-9783642751387","title":"Biological Signal Transduction","description":"Specialists in biochemistry and cell biology of cellular communication give an overview of current knowledge in this field.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52342134800657,"sku":"NLS9783642751387","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751387.jpg?v=1758172423"},{"product_id":"trafficking-of-intracellular-membranes-book-maria-c-pedroso-de-lima-9783642795497","title":"Trafficking of Intracellular Membranes:","description":"This volume contains the lectures presented at the NATO Advanced Study Institute (ASI) on Trafficking of Intracellular Membranes: From Molecular Sorting to Membrane Fusion, held in Espinho, Portugal, from June 19 to June 30,1994. The objective of this Institute was to survey recent developments and to discuss future directions in the rapidly advancing field of membrane cell biology, with particular emphasis on the dynamical properties and intracellular flow of membranes. A wide range of interrelated topics around the central theme of intracellular trafficking of membranes was covered, including lipid flow, membrane fusion, dynamics of membrane components, protein folding and assembly, vesicular transport in membrane biogenesis, exocytosis and endocytosis. A large variety of experimental techniques and systems, including the application of viruses and model systems, to study these processes was also considered. Membrane cell biology is a broad discipline which encompasses many scientific areas including cell biology, biochemistry, biophysics, virology, immunonology and genetics. Indeed, recent advances in the cell biology of membranes could not have been made without this multidisciplinary approach. Significant progress achieved during the last few years in understanding how newly synthesized lipids and proteins find their way to the cell organelles, how molecular sorting and the continuous flow of membranes allow each cellular membrane to maintain its own distinct molecular composition, and, thereby, the individuality of the various intracellular compartments, was discussed in considerable detail in this Institute.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52342577004817,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52342577561873,"sku":"NLS9783642795497","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642795497.jpg?v=1758172815"},{"product_id":"recognition-and-response-in-plant-virus-interactions-book-ronald-ss-fraser-9783642741661","title":"Recognition and Response in Plant-Virus Interactions","description":"Mechanisms of resistance to plant viruses are diverse, and probably involve different types of recognition events. Often, a cascade of changes affecting broader aspects of defence and metabolism is switched on progressively after the initial recognition event. Virulence, i.e. resistence-breaking behaviour of the virus, involves a failure or alteration of recognition or subsequent signalling. Consequences of these recognition events are the ways in which the pathogenic effects on the host are exerted: formation of visible symptoms and control of plant growth. This volume offers a comprehensive coverage of the recognition and signalling events between plants and viruses whereby the particular attraction of viruses (and viroids) is that they can now be completely defined in molecular terms: they offer excellent opportunities for studying the molecular biology of signalling, and may even provide useful guidelines on how plants and cellular pathogens interact.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52343550017809,"sku":"NLS9783642741661","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741661.jpg?v=1758173836"},{"product_id":"phytochrome-properties-and-biological-action-book-brian-thomas-9783642751325","title":"Phytochrome Properties and Biological Action","description":"Internati. onal meetings dev. oted exclusively t. o phytochr. ome are relatively infrequent. The Advanced Research W. orksh. op . on Phyt. ochr. ome Properties and Bi. ol. ogical Acti. on held in July 1990 at Bish. op Otter C. ollege in Chichester, an . old English cathedral t. own situated between the s. outh d. owns and the sea, provided a rare . opportunity fur th. ose w. orking directly . on the mechanism . of phyt. ochr. ome acti. on t. o get t. ogether fur a focused and intensive peri. od . of discussi. on . on the subject. The number . of delegates was limited t. o fifty but c. ontained representatives from alm. ost all the maj. or lab. orat. ories engaged in this area . of science. In a five day meeting there were twenty invited lectures, f. our round tables and three p. oster sessi. ons which all. owed all delegates t. o present and discuss their w. ork. The purp. ose . of the meeting was t. o review, in depth, the current -state . of kn. owledge c. oncerning the properties . of the plant ph. otorecept. or, phyt. ochr. ome, in relati. on t. o its mechanism . of bi. ol. ogical acti. on. The central themes . of the meeting were the applicati. on . of m. olecular bi. ol. ogy t. o pruvide maj. or new insights int. o the phyt. ochrume system and the integratiun uf m. olecular, genetic and bi. ochemica1 infurmati. on t.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52344149410065,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52344150032657,"sku":"NLS9783642751325","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751325.jpg?v=1758174363"},{"product_id":"neurobiology-of-the-inner-retina-book-reto-weiler-9783642741517","title":"Neurobiology of the Inner Retina","description":"The relatively simple, stratified nature of the retina and its spe- fied use in the visual process has long made it an inviting tissue to study both for its own sake and as a model for the more complex processes of the brain. For these dual purposes, the retina can be thought of as basically consisting of two functional pans. First, the outer retina, comprised of the photoreceptor cells and attendant pigment epithelium, serves to capture the photic energy and convert it into a neurochemical response. Second, the inner layers of the retina, mainly bipolar, amacrine and ganglion cells (and their attendant Maller cells), function more clearly as a typical part of the CNS, transmitting the photic signals to the brain. Between the 8th and 12th of August 1988 more than seventy scientists from allover the world gathered in Oldenburg (Federal Republic of Gennany) for a meeting The neurobiology of the inner retina which was devoted entirely to the neural mechanism of the inner synaptic layer of the verte- brate retina. The meeting comprised twenty - three separate lectures and four specially arranged discussion groups. In addition, a number of posters were displayed and a period was allotted specifically for the discussion of these posters. The articles contained in this book will serve as a record of the papers delivered at the Oldenburg Meeting and illustrate the advances made in trying to understand the importance of the diversity of amacrine cell morphology and physiology in retinal function.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52348885074193,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52348885696785,"sku":"NLS9783642741517","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741517.jpg?v=1758178763"},{"product_id":"early-effects-of-radiation-on-dna-book-em-fielden-9783642751509","title":"The Early Effects of Radiation on DNA","description":"Interest in the biological effects of ionising radiation closely followed the identification of such radiation. The realisation that DNA is the site of genetic infonnation in cells subsequently focussed attention on DNA as an important target in the lethal and mutagenic effects of ionising radiation. Thus radiation effects upon DNA became an important area for fundamental scientific studies by radiation biologists, chemists and physicists. To a first approximation, the concerns of the three disciplines can be divided by time scales: the physical process of energy deposition from photon or charged 16 12 particle and subsequent relaxation (-10- to 10- secs), followed by chemical 12 2 reactions (- 10- to 10 secs), and fmally, the expression of biological effect (minutes to years). Thus, the concept of 'early processes' conveys different ideas to different scientists, although they are all interrelated. To attempt to describe in any detail all these processes is a mammoth task which is not made easier by the different conventions and experimental approaches of the three disciplines. However, the recent advances in all these scientific areas seemed, to the organisers at least, to offer the opportunity to stimulate more active interaction between physicists, chemists and biologists. With this in mind, a multi-disciplinary workshop was organised, which brought together some fifty scientists to present their own specialist interests and, through extensive discussion, explore which problems are of high priority and require input from the different disciplines to resolve them.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52349349069073,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52349349691665,"sku":"NLS9783642751509","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751509.jpg?v=1758179222"},{"product_id":"calcium-transport-and-intracellular-calcium-homeostasis-book-danielle-pansu-9783642839795","title":"Calcium Transport and Intracellular Calcium Homeostasis","description":"The crucial role played by calcium as a cellular messenger has become increasingly evident, as has the recognition that cells spend much energy in maintaining the cytosolic concentration of this cation both constant and low. It is thought they do this to avoid precipitating phosphate, needed as a source of bond energy and to modulate protein structure. Moreover, since calcium that does enter the cell must be disposed with, processes that utilize calcium have evolved, e.g. secretion, contraction, signaling, to name just some. New knowledge concerning the processes of cellular calcium entry, extrusion and the fate of intracellular calcium has accumulated in recent years. Much has also been learned about calcium transport by and across epithelial cells. It seems logical to think that the processes of calcium entry, extrusion and intracellular handling are similar in all cells. We have therefore assembled in one volume overviews and research reports of transport and cellular calcium regulation so as to explore similarities and differences between cells that utilize calcium for metabolic purposes and those whose primary function is transport.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52349370138897,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52349374529809,"sku":"NLS9783642839795","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839795.jpg?v=1758179236"},{"product_id":"cellular-and-molecular-biology-of-myelination-book-gunnar-jeserich-9783642839702","title":"Cellular and Molecular Biology of Myelination","description":"Experts in the field of cellular and molecular biology of myelination present their latest results. Various techniques were used such as tissue culture, transplantation, transfection, immunocytochemistry and approaches to study the phylogenetic aspects of myelination as well as molec- ular biology. Concerning glial cells: hormones and second messengers play an important role in the regulation of the phenotype and the expression of myelin components at the transcriptional level; these findings are also part of particular relevance for remyelination. Concerning myelin: compositional studies revealed an increasing number of minor components to be of crucial importance for cellular adhesion processes; from a phylogenetic point of view vertebrate myelin has existed for 400 million years with important alterations in its compositon. This book offers a superb collection of the latest results presented by internationally reknowned scientists.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52349644308753,"sku":"NLS9783642839702","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839702.jpg?v=1758179499"},{"product_id":"genetics-of-translation-book-mick-f-tuite-9783642731419","title":"Genetics of Translation","description":"Translation, i.e. protein synthesis, studied from a genetic viewpoint is illustrated in this volume, demonstrating how researchers are employing both classical genetic and recombinant DNA techniques in studying the components, mechanisms, regulation and accuracy of protein synthesis. Both the prokaryotic (especially Escherichia coli) and eukaryotic (especially Saccharomyces cerevisiae) system are discussed, presenting both new information and the new genetic approaches available. This book does not concentrate on one particular aspect of translation, but provides an ideal overview of the genetic approaches for dissecting the translation process as well as the current rapid advances made in the field through the use of in vitro genetics.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52349688643857,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52349692412177,"sku":"NLS9783642731419","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642731419.jpg?v=1758179527"},{"product_id":"translational-apparatus-of-photosynthetic-organelles-book-r-mache-9783642751479","title":"The Translational Apparatus of Photosynthetic Organelles","description":"The book presents and discusses recent findings on protein synthesis in chloroplasts, the photosynthetic organelles.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52350093820177,"sku":"NLS9783642751479","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751479.jpg?v=1758179914"},{"product_id":"signal-perception-and-transduction-in-higher-plants-book-raoul-ranjeva-9783642839764","title":"Signal Perception and Transduction in Higher Plants","description":"In contrast to animals, plants are immobile and, thus, cannot leave a drastically changed environment. Therefore, plants have developped specific strategies involving particular signal and transduction systems as well as a form of cellular organization that allow them to buffer against sudden changes in external conditions. This state-of-the-art summary written by leading scientists deals with: - the most recent data available on the molecular mechanism involved in the response of plant cells to different stimuli; - the critical domaine of ignorance such as the signifi cance of site occupancy of receptors for growth substances; - the estimation of the applicability of new techniques such as electrophysiology, cell imaging and DNA recombinant technology; - directions for future work.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52350149624081,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52350150148369,"sku":"NLS9783642839764","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839764.jpg?v=1758179963"},{"product_id":"theoretical-and-experimental-insights-into-immunology-book-alan-s-perelson-9783642769795","title":"Theoretical and Experimental Insights into Immunology","description":"Immunology is largely a science of observation and experimentation, and these approaches have lead to great increases in our knowledge of the genes, molecules and cells of the immune system. This book is an up-to-date discussion of the current state of modelling and theoretical work in immunology, of the impact of theory on experiment, and of future directions for theoretical research. Among the topics discussed are the function and evolution of the immune system, computer modelling of the humoral immune response and of idiotypic networks and idiotypic mimicry, T-cell memory, cryptic peptides, new views and models of AIDS and autoimmunity, and the shaping of the immune repertoire by early presented antigens and self immunoglobulin.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52351362957585,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52351366725905,"sku":"NLS9783642769795","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642769795.jpg?v=1758180998"},{"product_id":"molecular-techniques-in-taxonomy-book-godfrey-m-hewitt-9783642839641","title":"Molecular Techniques in Taxonomy","description":"Taxonomy is fundamental to understanding the variety of life forms, and     exciting expansions in molecular biology are re- volutionising the obtained data. This volume reviews the ma- jor molecular biological techniques that  are applied in ta- xonomy. The chapters are arranged in three main sections:1) Overviews of important topics in molecular taxonomy; 2) Case studies of the successful application of molecular methods to taxonomic and         evolutionary questions; 3) Protocols for a range of generally applicable    methods. The described techni- ques include DNA-DNA hybridization, DNA      fingerprinting, RFLP analysis, and PCR sequencing.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52351461851409,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52351465455889,"sku":"NLS9783642839641","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839641.jpg?v=1758181067"},{"product_id":"dynamics-and-biogenesis-of-membranes-book-josef-af-op-den-kamp-9783642741968","title":"Dynamics and Biogenesis of Membranes","description":"Membrane proteins, lipids and their glycosylated derivatives are discussed both with respect to their biosynthesis as well as regarding their mutual interaction and assembly into functional membranes. Topics cover a large variety of systems and cells: investigation on virus membranes as well as pro- and eukaryotic cells are included.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52351798378769,"sku":"NLS9783642741968","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741968.jpg?v=1758181316"},{"product_id":"biomechanics-of-active-movement-and-deformation-of-cells-book-nuri-akkas-9783642836336","title":"Biomechanics of Active Movement and Deformation of Cells","description":"Cytomechanics is the application of the classical principles of mechanics in cell biology. It is an applied science concerned with the description and evaluation of mechanical properties of cells and their organelles as well as of the forces exerted by them. Thus, this topic needs a truly interdisciplinary approach, and accordingly this volume gives an up-to-date account of the current research done on cell division, mitosis, cytokinesis, cell locomotion and cell deformation during normal development and the cytoskeletal role in cell shape. Biologists, biomechanicians, biophysicists, biochemists and biomathematicians here discuss the basic concepts of mechanics and thermodynamics, emphasizing their applicability to cell activities.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52352002720017,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52352006455569,"sku":"NLS9783642836336","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642836336.jpg?v=1758181514"},{"product_id":"molecular-evolution-of-the-major-histocompatibility-complex-book-jan-klein-9783642846243","title":"Molecular Evolution of the Major Histocompatibility Complex","description":"From molecules to populations and back In biology, the most vigorous organisms often ensue from a union of two disparate, pure lines. In science, too, laws of hybrid vigor seem to operate at the interface between two disciplines, an interface that often proves to be fertile ground for germinating concepts and new outlooks. The fringes of research into the major histocompatibility complex (Mhc) have provided such an interface several times in the past and the encounters have invigorated fields such as transplantation biology, cellular immunology, and immunogenetics. In the last few years, a new interface has been emerging between Mhc and evolutionary genetics, and particularly the branch of evolutionary genetics dealing with molecular evolution. Mhc research relies upon molecular evolutionary genetics, with its grand superstructure of mathematical formulations, to come to grips with the events leading to and maintaining the Mhc polymorphism. Without the armament of rigorous statistical procedures developed by evolutionary geneticists, the intricate relationships among Mhc genes cannot be resolved. It will undoubtedly be a molecular geneticist who is the final arbiter in the dispute concerning the nature of the selection pressure molding the Mhc genes. And it is doubtful whether the true function of Mhc can ever be comprehended without the vantage point afforded by the elucidation of its evolutionary history.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52352136118545,"sku":"NLS9783642846243","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ NEW \/ INGRAM","offer_id":52932512383249,"sku":"NIN9783642846243","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846243.jpg?v=1758181638"},{"product_id":"molecular-biology-of-neuroreceptors-and-ion-channels-book-alfred-maelicke-9783642741579","title":"Molecular Biology of Neuroreceptors and Ion Channels","description":"This workshop was the second of this series held on the island of santorini in the Cycladic Sea. The first one (Mechanism of Action of the Nicotinic Acetylcholine Receptor, NATO ASI Se- ries H, vol. 10) took place in May 1986 and focused on what was at the time the best studied of all neuroreceptors. This second one, held only two years later, demonstrates the im- mense progress achieved since then in the field of neurorecep- tors and ion channels. Molecular cloning techniques have now made available the primary structures of a whole array of ion channel proteins, and this in turn has shed light on some gen- eral principles of the structure-function relationships of these central elements of intercellular communication. The purpose of this workshop was to explore the common ele- ments in gene and protein structure of already cloned ion channel proteins, and to assess the status of other cloning projects in progress. It explicitly focused on very recently published and unpublished results. All participants kept to these goals thereby demonstrating the very value of such work- shops for the progress of science.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52352455147793,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52352455803153,"sku":"NLS9783642741579","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741579.jpg?v=1758181911"},{"product_id":"flow-cytometry-book-alain-jacquemin-sablon-9783642846182","title":"Flow Cytometry","description":"Described here are the practical applications of flow cytometry in specific biological systems, ranging from cell biology to chromosome analysis and sorting. Three major areas of interest in cell and molecular biology are addressed: - Cell Activation and Biological Response. - Membrane-Ligand Interactions and Cell Identity. - Nuclear Components: Form and Function. Data management, expert systems and cell sorting techniques concerning all aspects of flow cytometry are also presented.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52352509214993,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52352513081617,"sku":"NLS9783642846182","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846182.jpg?v=1758181951"},{"product_id":"chemosensory-information-processing-book-detlev-schild-9783642751295","title":"Chemosensory Information Processing","description":"In July 1989 a symposium was held at the Physiology Department of the Georg August University, G6ttingen, on the physiological, biophysical, biochemical, and technical principles of the coding of chemical substances both in nervous systems and artificial devices. This book is the collection of the papers presented at that meeting. Biological and artificial systems for odor coding both have in common that the stimulus selectivity of the receptor cells (sensors) is usually very poor, and the mechanisms which determine selectivity and sensitivity are largely unknown. However, a poor selectivity allows the coding of an enormous number of stimuli by combinations of receptor activities. In the field of chemosensory information coding there are thus two major problems: the function of the receptors and the network that processes and evaluates the primary information of the sensors. Accordingly, this volume has three parts: sensors, the network following the sensors, and the coding in this network. The expert secretarial assistance of M. Holtmann in preparing the camera-ready manuscript is gratefully acknowledged. D. Schild G6ttingen, August 1989 CONTENTS l. Response of olfactory receptor cells, isolated and in situ, to low concentrations of odorants 1 Stephan Frings, Bernd Lindemann 2. Excitation and adaptation of frog olfactory receptor neurones upon stimulation with second messengers and natural odorants 9 D. Schild, J. A. DeSimone, S. Hellwig 3. Receptor selectivity and dimensionality of odours at the stage of the olfactory receptor cells 21 GiJJes Sicard 4.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52352793346321,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52352794034449,"sku":"NLS9783642751295","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751295.jpg?v=1758182296"},{"product_id":"endocytosis-book-a-dautry-varsat-9783642842979","title":"Endocytosis","description":"(Director: Pierre J. COURTOY) Two years after its first gathering in Oeiras, Portugal, the European Endocytosis Group convened for a second workshop at the Pasteur Institute, Paris, on October 1-5, 1990. The meeting is reported in detail in this volume; a preliminary coverage, based on the overviews of each session, has appeared in the New Biologist (1991, 3:243-252). The three main objectives, to broaden the audience, to present a more comprehensive view of the multiple aspects of endocytosis, from basic biology to health, disease and therapy, as well as to clarify controversial issues, have been largely fulfilled. The Second European Workshop on Endocytosis was attended by more than tO participants, originating from 18 countries. 59 lectures and 35 posters were presented. In addition, vivi roundtables allowed to thoroughly discuss the dynamics and the regulation of the endocytic apparatus, as well as the role of endocytosis in antigen presentation. Endocytosis is a general and distinctive property of all eukaryotic cells, including protists, plants and fungi.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353066270993,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353066926353,"sku":"NLS9783642842979","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642842979.jpg?v=1758182560"},{"product_id":"vectors-as-tools-for-the-study-of-normal-and-abnormal-growth-and-differentiation-book-heinz-lother-9783642741999","title":"Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation","description":"Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al. , 1986; Miyajima et al. , 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor\/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al. , 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa- tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 * -96 -84 GGAGATTCCCC IL-2R (p55) ...","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353236140305,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353239777553,"sku":"NLS9783642741999","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741999.jpg?v=1758182735"},{"product_id":"signalling-mechanisms-from-transcription-factors-to-oxidative-stress-book-lester-packer-9783642796777","title":"Signalling Mechanisms — from Transcription Factors to Oxidative Stress","description":"A NATO Advanced Study Institute on \"Molecular Mechanisms of Transcellular Signaling: from the Membrane to the Gene\" was held on the Island of Spetsai, Greece, from August 15- 27, 1994. The aim of this Institute was to bring together researchers in the field of signal transduction mechanisms, transcription factors and gene regulation with those actively involved in studies on the implications of oxygen radicals and antioxidant defence mechanisms for cell function. As diverse as these fields may be, the emergence of their interconnection during the course of the Institute was an eye-opener for students and lecturers alike. 2 Presentations and discussions focussed on the role of Ca +, G-proteins, protein kinase C and phospholipases in signaling mechanisms. These broad principles were extended to transcription factors and gene regulation with an emphasis on the steroid hormone receptor superfamily and NFKB. Basic principles of free radical formation and antioxidant action (vitamin E and C) were presented and discussed in connection with effects on signaling pathways. This book present the content of the major lectures and a selection of the most relevant posters. These proceedings offer a comprehensive account of the most important topics discussed at the Institute. The book is intended to make the proceedings accessible to a large audience.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353553400081,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353553858833,"sku":"NLS9783642796777","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642796777.jpg?v=1758183032"},{"product_id":"regulatory-mechanisms-of-neuron-to-vessel-communication-in-the-brain-book-fiorenzo-battaini-9783642741548","title":"Regulatory Mechanisms of Neuron to Vessel Communication in the Brain","description":"Different molecular mechanisms cooperate to the regulation hormones, local metabolic of brain microcirculation: products, transmitterso Great interest has recently emerged in literature on the neuronal systems controlling the blood brain barrier and on the reciprocal interaction between neuronal activity and vascular supply. In particular, this volume on the NATO Advanced Research Workshop held in Salo' (BS), Italy, September 3-8, 1988, outlines the importance of neuron-vessel communication in the regulation of cerebral microenvironment. The problem is approached from a multidisciplinary point of viev, with contributions coming from basic and clinical areas. Stimulating results emerge from in vivo imaging techniques which allow the investigation of the hemodynamic and metabolic activities of the brain in various physiological and pathological conditions, such as aging or dementia. This methodology is of fundamental importance to acquire deeper knowledge on the relationship between cerebral blood flow, metabolism and higher brain funetions. Another stimulating aspeet addressed in this volume is the role of the glia in maintaining the homeostasis of the neuronal microenvironment, by buffering the excess of ions in the extracellular space and regulating the vascular transport processes. The complex interplay neuron-glia-vessel may indicate new perspectives in the therapy of cerebrovascular disorders, suggesting as a target for pharmacological intervention the VI neuronal (or glial) eelIs partieipating to the exchange of ions and substanees responsible for the extension of the isehemie damage.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353622278417,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353622999313,"sku":"NLS9783642741548","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741548.jpg?v=1758183110"},{"product_id":"signal-molecules-in-plants-and-plant-microbe-interactions-book-ben-jj-lugtenberg-9783642741609","title":"Signal Molecules in Plants and Plant-Microbe Interactions","description":"Proceedings of the NATO Advanced Research Workshop on Molecular Signals in Microbe-Plant Symbiotic and Pathogenic Systems, held at Biddinghuizen, The Netherlands, May 21-26, 1989","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353804468497,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353804861713,"sku":"NLS9783642741609","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642741609.jpg?v=1758183276"},{"product_id":"vascular-wilt-diseases-of-plants-book-ec-tjamos-9783642731686","title":"Vascular Wilt Diseases of Plants","description":"It is apparent that wilt diseases continue to be a major problem in crop production because of the number of crops affected, the number and genetic variability of pathogens involved, and their widespread occurrence throughout tropical and temperate regions under a variety of cropping systems. It is also apparent, however, that new understandings and approaches, often in combinations not previously discerned, offer exciting new prospects for research, understanding and practical control methods. The current state-of-the-art and fields for further studies were discussed by researchers actively engaged in a wide range of areas from ecological studies of physical and biological factors in the host-parasite-environmental interactions in the soil, through physiological and biochemical studies of host-parasite recognition and interaction that determine relative colonization of the host, through genetic-molecular studies of these interactions, to the most practical field studies of disease control.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52353971945745,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52353975517457,"sku":"NLS9783642731686","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642731686.jpg?v=1758183424"},{"product_id":"molecular-biology-and-its-application-to-medical-mycology-book-bruno-maresca-9783642846274","title":"Molecular Biology and its Application to Medical Mycology","description":"Presented here are recent achievements in molecular biology of non-pathogenic yeast and filamenous fungi as well as of human pathogens. Thebook is diveded into 4 sections: - Molecular Biology of Yeast; - Molecular Biology of Filamenous Fungi; - New Tools and Prospectives for Medical Mycology; - Fungal Morphogenesis. It focuses on aspects of medical mycology, namely isolation of specific genes and strategies for developing new targets for antifungal therapy.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52353987543313,"sku":"NLS9783642846274","price":0.0,"currency_code":"GBP","in_stock":true},{"title":"US \/ NEW \/ INGRAM","offer_id":52932513595665,"sku":"NIN9783642846274","price":0.0,"currency_code":"GBP","in_stock":false}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642846274.jpg?v=1758183431"},{"product_id":"molecular-biology-of-autoimmune-disease-book-andrew-g-demaine-9783642751356","title":"The Molecular Biology of Autoimmune Disease","description":"Autoimmune diseases are common and often associated with considerable morbidity or - in diseases such as IDDM, myasthenia gravis and multiple sclerosis - mortality. In this volume, experts of international stature in basic science and clinical medicine with a common interest in understanding the normal and aberrant immune response present their experiences. It was their intention to fur- ther the understanding of potential clinical application of scientific observations and to help to comprehend the huge amount of results in autoimmunity research.","brand":"WoB","offers":[{"title":"GB \/ NEW \/ INGRAM","offer_id":52354075885841,"sku":"NLS9783642751356","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642751356.jpg?v=1758183531"},{"product_id":"parallels-in-cell-to-cell-junctions-in-plants-and-animals-book-aw-robards-9783642839733","title":"Parallels in Cell to Cell Junctions in Plants and Animals","description":"Intracellular junctions provide routes for direct cell-to-cell signalling in both plants and animals. The present volume treats the parallels and differences between such junctions in animals and plants and discusses the most recent methods of examining the physiological functions and regulation of intracellular communication. Strong evidence of both molecular as well as functional simi larities between plasmodesmata and gap junctions is increasing. Even more interesting is the discovery that animal gap junction proteins cross-react immunologically with some proteins in plant cells. Thus the molecular construction and function of these crucially important ultrastructural cell components is now open to a concerted research effort to understand how cells, both plant and animal, facilitate and regulate intercellular transport.","brand":"WoB","offers":[{"title":"- \/ - \/ INTERNAL","offer_id":52354143748369,"sku":null,"price":0.0,"currency_code":"GBP","in_stock":true},{"title":"GB \/ NEW \/ INGRAM","offer_id":52354147451153,"sku":"NLS9783642839733","price":0.0,"currency_code":"GBP","in_stock":true}],"thumbnail_url":"\/\/cdn.shopify.com\/s\/files\/1\/0784\/4072\/6801\/files\/9783642839733.jpg?v=1758183620"}],"url":"https:\/\/www.worldofbooks.com\/en-gb\/collections\/nato-asi-subseries-h-book-series.oembed?page=4","provider":"World of Books ","version":"1.0","type":"link"}